Engineered extrachromosomal oncogene amplifications promote tumorigenesis – Nature

Plasmids and viral vectors

Plasmids containing the circularization cassettes were generated using a NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs, E5520S) and KLD Enzyme Mix (New England BioLabs, M0554S) and validated by Sanger sequencing. Purified, high-titre recombinant adenoviruses encoding Cre (AdCre) were purchased from ViraQuest (VQ-Ad-CMV-Cre; 1 × 10¹² particles per millilitre; catalogue no. 091317) and University of Iowa (Ad5CAGCre; VVC-U of Iowa-8193, University of Iowa). pBABE-Puro and pBABE-Puro-HRAS^G12V plasmids were obtained from Addgene. For retrovirus production, HEK-293T cells were seeded in high-glucose Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) without antibiotics in 100 mm petri dishes. The next day, cells at approximately 60–70% confluence were transfected with 20 µg of retroviral vector carrying the HRAS^G12V cDNA or a control vector, 5 µg of packaging plasmid and 1 µg of envelope plasmid. After 24 h, the medium was replaced with DMEM with antibiotics. Cells were incubated for 48 h with two consecutive collections of the medium containing the retroviral particles at 24 and 48 h. Medium collected at 24 and 48 h was filtered using a 0.45 µm filter unit and used to transduce MEF cells. Retroviral infection was performed, incubating cells with viral supernatant supplemented with polybrene (0.2 µl ml⁻¹; Millipore Sigma, TR-1003G).

Cell culture

The culture medium for HCT116 cells (ATCC, CCL-247) was McCoy’s 5a Medium Modified (Thermo Fisher Scientific, catalogue no. 16600108) supplemented with 10% heat-inactivated FBS (Sigma-Aldrich, F2442), penicillin–streptomycin (100 U l⁻¹; Gemini Bio-Products, catalogue no. 400-109). For selection of targeted cells engineered with the circularization cassettes, the following antibiotics were used: puromycin (2 μg ml⁻¹; Sigma-Aldrich, P9620), hygromycin B (200 μg ml⁻¹; Thermo Fisher Scientific, catalogue no. 10687010). HEK-293T cells for viral vector production were cultured in high-glucose DMEM (4.5 g l⁻¹; Thermo Fisher Scientific, catalogue no. 11995065) with 10% heat-inactivated FBS, l-glutamine (2 mM), and penicillin–streptomycin (100 U l⁻¹).

MEFs with different genotypes were isolated from E13.5 mouse embryos and propagated in high-glucose DMEM supplemented with 10% heat-inactivated FBS, l-glutamine (2 mM) and penicillin–streptomycin (100 U l⁻¹).

aNSCs were isolated and cultured following the protocol described by Ahmed et al.⁴⁴. Upon isolation, aNSC were maintained as neurospheres and then allowed to attach to laminin-coated (Sigma-Aldrich, L2020) dishes in NeuroCult Stem Cell Basal Media with NeuroCult Proliferation Supplement (Mouse & Rat) (Stem Cells Technologies, catalogue no. 05702), 20 ng ml⁻¹ EGF (Stem Cells Technologies, catalogue no. 78006), 10 ng ml⁻¹ bFGF (Stem Cells Technologies, catalogue no. 78003), and 2 μg ml⁻¹ heparin (Stem Cell Technologies, 07980).

Cerebellar stem cells were isolated from the cerebella of 5-day-old mice. Cerebella were digested using a Papain Dissociation system (Worthington, LK003150) to obtain a single-cell suspension. Cells were washed and suspended in flow buffer (phosphate-buffered saline (PBS) supplemented with 2% heat-inactivated FBS (Sigma-Aldrich, F2442), 2 mM EDTA and 25 mM HEPES (Thermo Scientific, catalogue no. 15630080)) and passed through a 40 µm cell strainer. Cells were stained for prominin-1 and lineage markers and sorted. Cerebellar stem cells (prominin-1-positive, lineage-negative) were allowed to attach to laminin-coated (Sigma-Aldrich, L2020) dishes in NeuroCult Stem Cell Basal Media with NeuroCult Proliferation Supplement (Mouse & Rat) (Stem Cells Technologies, catalogue no. 05702), 20 ng ml⁻¹ EGF (Stem Cells Technologies, catalogue no. 78006), 10 ng ml⁻¹ bFGF (Stem Cells Technologies, catalogue no. 78003) and 2 μg ml⁻¹ heparin (Stem Cell Technologies, catalogue no. 07980).

Primary hepatocytes were isolated from the livers of adult mice. Following euthanasia, the liver was rapidly perfused with PBS, chopped into small pieces and digested in 3.42 mg ml⁻¹ dispase II (Roche, catalogue no. 04942078001) and 1 mg ml⁻¹ collagenase IV (Sigma-Aldrich, C5138) in DMEM. The hepatocyte fraction was isolated by centrifugation at 200g and plated on collagen-coated plates. Culture media for hepatocytes consisted of William’s E media (Gibco, A1217601) with supplements: 10% heat-inactivated FBS (Sigma-Aldrich, F2442), 10 mM nicotinamide, 2 mM glutamine, 0.1 mM dexamethasone, 1× ITS+ (Gibco, catalogue no. 41-400-045), 0.2 mM ascorbic acid, 20 mM HEPES (Thermo Scientific, catalogue no. 15630080), 1 mM sodium pyruvate, 14 mM glucose (Gibco, A2494001), penicillin–streptomycin (100 U l⁻¹). Hepatocytes were subsequently immortalized by infection with Ad-Tbg-Cre (Addgene, 107787-AAV8).

All cells were negative for mycoplasma contamination. Cells were maintained in a humidified, 5% CO₂ atmosphere at 37 °C.

In vivo tumorigenesis

For in vivo tumour formation assays, nude mice were injected in the flank with 400,000–1,000,000 pBABE-Puro-HRASG12V transduced MEFs of the indicated genotype. Mice were monitored every 2–3 days and euthanized when the tumour volume reached 2 cc.

ATAC-seq analysis

ATAC-seq libraries were generated and sequenced by the Memorial Sloan Kettering Cancer Center (MSKCC) genomic core. Fastq files from ATAC-seq and WGS were aligned to the mouse genome (mm10) using Bowtie2. Then, CNVkit (v.0.9.10) was applied to WGS bam files to identify copy number variations and ecDNA amplicon regions. To compare ATAC-seq signals between ecDNA amplicons and corresponding chromosomal regions, bamCoverage in deeptools (v.3.5.3) was used to calculate read counts with 10 kb bin size, and MACS (v.3.0.0b1) was used for peak calling. Read counts and peak numbers were normalized by segment length (10 kb), sequencing depth and copy number.

Homologous recombination in HCT116 cells

HCT116 cells were obtained directly from ATCC (ATCC, CCL-247). Cas9 protein, CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) were purchased from Integrated DNA Technologies and preassembled by incubation according to the manufacturer’s instructions.

The two circularization cassettes were introduced sequentially. The donor cassettes were amplified using primers containing an 80 nucleotide 5′ homology sequence to the desired targeting site. Then, 100–500 ng of gel-purified PCR products were transfected into 500,000 HCT116 cells plated the day before in a well of a six-well plate using Lipofectamine 3000 (Thermo Fisher, L3000008). Two hours later, the preassembled Cas9–crRNA–tracrRNA were introduced using Lipofectamine CRISPR-Max (Thermo Fisher, CMAX00008) following the manufacturer’s instructions. Selection with either puromycin (5′ cassette, 2 µg ml⁻¹) or hygromycin (3′ cassette, 200 µg ml⁻¹) was started 48 h after transfection. Surviving clones were isolated and screened by PCR, followed by Sanger sequencing to detect correct targeting.

Animals

All animal experiments were approved by the Institutional Animal Care and Use Committee of MSKCC. To generate the Myc^ec (JAX strain: 039221) and Mdm2^ec (JAX strain: 039222) mouse strains in a C57BL/6J background, zygote electroporation based on published protocols⁴⁵ was carried out by the MSKCC Mouse Genetics Core Facility using crRNAs experimentally validated in mouse embryonic stem cells. Briefly, multiple zygotes placed in an electrode chamber were subjected to electroporation at one time. Each electroporation mixture contained the 5′ (AGATGCGCACAGAAAAGTGG) and 3′ (ATCATGAGTTGAGTTCACTC) breakpoint targeting crRNAs (25 ng μl⁻¹), S.p. Cas9 V3 protein (100 ng μl⁻¹; IDT), and two single-stranded oligodeoxynucleotides of 159 bp with asymmetric homology arms (200 ng μl⁻¹) in a solution of 0.1% polyvinyl alcohol. Electroporated zygotes were cultured in KSOM medium at 37 °C and 5% CO₂ until the two-cell stage; after that, they were transferred to the oviducts of pseudopregnant females on the day of the vaginal plug. N₀ animals generated from the zygotes were genotyped and Sanger sequenced to confirm insertion of both loxP sites. Double-targeted N₀ mice were mated to C57BL/6J wild-type mice to generate Myc^ec/+ F₁ progeny. Primers for genotyping are listed in Supplementary Table 4. The Mdm2^ec mouse was also generated as described above, except that guide RNAs were used to target chr. 10: 116711442 (TCTTACAGCATACTACGGTC TGG) and chr. 10: 118002454 (TTCTGCGATTCGTTATGCGT AGG) for the 5′ and 3′ loxP insertion sites, respectively.

Liver tumours were generated by hydrodynamic tail-vein injection of a solution of sterile saline containing 25 µg of pT3-EF1a-MYC-IRES-Luc and 5 µg of transposase-encoding vector (SB13). In brief, a volume equivalent to 10% of the mouse’s body weight was injected through the tail vein using a 3 ml syringe with 26-gauge × 5/8-inch needle. A mix of male and female mice were used for these experiments. Mice were monitored for tumour development and euthanized at the humane end point. The CMV-SB13 and pT3-loxP-EF1a-MYC-IRES-Luc-loxP were gifts from A. Lujambio (Icahn School of Medicine at Mount Sinai). pT3-EF1a-MYC-IRES-Luc was generated by removing the loxP sites from pT3-loxP-EF1a-MYC-IRES-Luc-loxP. p53^fl (B6.129P2-Trp53tm1Brn/J) (strain: 008462)⁴⁶, Actin–Cre (B6N.FVB-Tmem163Tg(ACTB-Cre)2Mrt/CjDswJ (strain: 019099)³², Vil1–Cre (B6.Cg-Tg(Vil1-cre)1000Gum/J; strain: 021504)⁴⁷, Atoh1–Cre (B6.Cg-Tg(Atoh1-cre)1Bfri/J; strain: 011104)⁴⁸, Alb–Cre (B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J; strain: 003574)⁴⁹, Mx–Cre (B6.Cg-Tg(Mx1-cre)1Cgn/J; strain: 003556)²⁰ and Nestin–Cre (B6.Cg-Tg(Nes-cre)1Kln/J)^50,51 mouse strains were obtained from the Jackson Laboratory. Outbred athymic nude mice (stock: 007850) were purchased from the Jackson Laboratory.

Antibodies and immunoblots

Cells were lysed in Laemmli buffer, supplemented with protease (cOmplete; Roche, COEDTAF-RO) and phosphatase (EDTA-free Protease Inhibitor Cocktail; Roche, PHOSS-RO) inhibitors. Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and analysed by western blotting using standard procedures. After protein transfer, the nitrocellulose membranes (Bio-Rad, catalogue no. 1704271) were blocked by incubation with LICOR Intercept (TBS) blocking buffer. The following primary antibodies were used: anti-vinculin (1:5,000; Millipore, MAB3574), anti-c-MYC (1:1,000; Cell Signaling, D84C12), anti-MDM2 (1:1000; Cell Signaling, 51541), anti-α-tubulin (1:5000; Cell Signaling, 3873), anti-p53 (1:1000; Leica Biosystems, P53-PROTEIN-CM5) and anti-p21 (1:1000; Cell Signaling, 64016). The following secondary antibodies were used: IRDye 800 anti-rabbit (LICOR, 926-32213) and IRDye 680 anti-mouse (LICOR, 926-68072). Images were acquired using an Odyssey Imaging System (LICOR).

Flow cytometry and cell sorting

Flow cytometry analysis of ecMDM2 and invMDM2 HCT116 cells was performed following collection of cells in a single-cell suspension. Cells were resuspended in flow buffer (PBS supplemented with 2% heat-inactivated FBS (Sigma-Aldrich, F2442), 2 mM EDTA, and 25 mM HEPES (Thermo Scientific, catalogue no. 15630080)) and passed through a 40 µm cell strainer to remove clumps. DAPI (Thermo Scientific, D1306) staining was used to discriminate between live and dead cells. Flow cytometry analyses were performed on LSR Fortessa (BD Biosciences) instruments. Cells were first gated on the basis of size (forward scatter, FSC) and density and/or granularity (side scatter, SSC), excluding debris and doublets; DAPI staining was used to gate the live fraction. Then, polygonal or quadrant gates were applied to isolate the population of interest on the basis of GFP and mScarlet expression. The same protocol was used to sort ecMDM2 and invMDM2 HCT116 double-positive cells using FACSAria (BD Biosciences) and FACSymphony (BD Biosciences) instruments.

For isolation of cerebellar stem cells, cells were incubated for 1 h with Cd133 (prominin-1) monoclonal antibody (13A4)-FITC (1:100; Thermo Scientific 311-1331-80), Cd81 monoclonal antibody (Eat2)-PE (1:50; Thermo Scientific, MA517941), anti-O4-PE (1:50; Miltenyi Biotec., 130-117-507) and anti-PSA-NCAM-PE (Miltenyi Biotec. 130-117-394, 1:50). After staining, cells were washed and sorted using a BD FACSAria III instrument (BD Biosciences) according to prominin-1-positive and lineage-negative (Cd81⁻; O4⁻; PSA/NCAM⁻) marker expression. The gating strategy is provided in Supplementary Fig. 1, which contains the uncropped gel images.

Tissue processing and immunohistochemistry

Subcutaneous tumours and livers were fixed for 24 h in 10% formalin and then transferred to 70% ethanol for at least 24 h before paraffin embedding and sectioning. Unstained 5 μm tissue sections were deparaffinized in Histo-Clear II (Electron Microscopy Sciences, catalogue no. 64110-04) and rehydrated with graded alcohols to distilled water. Endogenous peroxidase activity was inactivated using 3% H₂O₂ (MP Biomedicals, catalogue no. 194057) for 15 min. Tissue slides were pretreated for antigen retrieval by heating in Antigen Unmasking Solution, Citrate-Based (Vector Laboratories H-3300) using a pressure cooker. Non-specific protein interactions were blocked in 10% normal serum for 30 min. Slides were incubated in primary antibody overnight at 4 °C at the following dilutions: HNF4α (1:500; CST, 3113T); CK19 (1:500; Abcam, AB52625). VectaStain ABC-HRP Rabbit IgG (Vector Laboratories, PK-6101) was used as the secondary antibody, with incubation according to the manufacturer’s instructions. ImmPACT DAB (Vector Laboratories SK-4105) was used as a substrate. Haematoxylin (Vector Laboratories, H-3401) was used as the counterstain. Cover slides were mounted with VectaMount Express Mounting Medium (Vector Laboratories, H-5700). Bright-field images were obtained using a Zeiss Axiocam microscope. Haematoxylin and eosin slides were examined by C.A. and C.S., board-certified pathologists with extensive expertise in human sarcomas and liposarcomas (C.A.) and human liver cancers (C.S.).

RNA extraction and qPCR with reverse transcription

Total RNA was isolated using an RNeasy Mini Kit (QIAGEN, catalogue no. 74106) according to the manufacturer’s instructions. After treatment with DNAse I (Ambion, AM2222), 1 μg of purified RNA was retrotranscribed with oligos d(T)₁₈ using a SuperScript IV First-strand System (Invitrogen, catalogue no. 18091050). For qPCR with reverse transcription (RT–qPCR), an aliquot of the RT reaction was analysed with PowerUp SYBR Green (Applied Biosystems, A25777) and a QuantStudio 6 Flex real-time PCR system (Applied Biosystems). Target transcript levels were normalized to those of the indicated reference genes. The expression of each gene was measured in at least three independent experiments.

Milademetan dose–response curve

A total of 1,500 cells were seeded in each well of a 96-well plate, with 100 µl of complete medium per well. Cells were allowed to adhere for 12 h in the incubator before the treatment was initiated. Milademetan (MedChemExpress, HY-101266) doses ranging from 20 to 10,240 nM were prepared, along with a vehicle control at the highest treatment dose. The doses were added to the respective wells in a volume of 100 µl, ensuring that the cells received milademetan doses ranging from 10 to 5,120 nM. After a 72 h incubation period, cell viability was determined using the Cell-TiterGlo assay (Promega, G7570), following manufacturer’s instructions. Briefly, the assay reagent was added to the wells, and the plates were gently agitated to ensure thorough mixing. The luminescence signal was then measured using a Synergy 2 plate reader (Biotek) according to the manufacturer’s guidelines.

Gene copy number assay

Myc, MDM2 and Mdm2 gene amplification was evaluated using TaqMan Copy Number Assays (probe Mm00734221_cn, probe Hs02873318_cn and probe Mm00312030_cn) using the QuantStudio 6 Flex real-time PCR system. Briefly, genomic DNA was amplified using the TaqPath ProAmp Master Mix (Applied Biosystems, A30865) kit and following the supplier’s instructions. TaqMan Copy Number Reference Assay (Tfrc, 4458367 and TERT, 4403316) were used in duplex as references for mouse and human genomes, respectively. Relative copy number variations were calculated using the ddCt method.

Digital droplet PCR

Assays specific for the detection of Cre-mediated circularization and excision of the mouse Myc^ec or Mdm2^ec allele were designed and ordered through Bio-Rad (Supplementary Table 4). Cycling conditions were tested to ensure optimal annealing and extension temperatures, as well as optimal separation of positive and empty droplets. Optimization was done with a known positive control. After PicoGreen quantification, 0.4–9.0 ng genomic DNA was combined with locus-specific primers, FAM- and HEX-labelled probes, BamHI and digital PCR Supermix for probes (no dUTP). All reactions were performed on a QX200 digital droplet PCR system (Bio-Rad, catalogue no.: 1864001), and each sample was evaluated in technical duplicates using Ptger2 as a reference. Reactions were partitioned into a mean of approximately 21,000 droplets per well using a QX200 droplet generator. Emulsified PCRs were run on a 96-well thermal cycler, using cycling conditions identified during the optimization step (95 °C 10 min; 40 cycles of 94 °C 30 s and 56 °C 1 min; 98 °C 10 min; 4 °C hold). Plates were read and analysed with QuantaSoft software (Bio-Rad; v.1.7) to assess the number of droplets positive for the gene of interest, reference gene, both or neither.

RNA-seq and gene set enrichment analysis

Paired-end RNA libraries were sequenced by the MSKCC integrated genomics core. Reads were mapped to mm10 using the STAR aligner⁵², and differential gene expression was calculated using the DESeq2 R package⁵³. For gene set enrichment analysis, genes were ranked on the basis of their moderated P value [−log₁₀(adjusted P) × sign(log₂(fold change))], and gene sets were obtained from the HALLMARK msigdb pathways database. Enrichment was calculated using the fgsea R package.

Shallow whole-genome sequencing

The sWGS was carried out by the Integrated Genomics Operation core at MSKCC. Briefly, after PicoGreen quantification and quality control by Agilent BioAnalyzer, 100 ng of genomic DNA was sheared using a LE220-plus Focused-ultrasonicator (Covaris, catalogue no. 500560), and sequencing libraries were prepared using a KAPA Hyper Prep Kit (Kapa Biosystems, KK8504) with eight cycles of PCR. Samples were run on a NovaSeq 6000 in a PE100 run, using a NovaSeq 6000 S4 Reagent Kit v.1.5 (200 cycles) (Illumina). Paired-end genomic DNA libraries were sequenced by the MSKCC integrated genomics core. Reads were mapped to mm10 or hg19 using the Bowtie2 aligner⁵⁴. To calculate genome coverage and copy number changes, we used the QDNAseq R package⁵⁵ with 15 kb bins. Plots were generated using the Gviz package⁵⁶.

Amplicon Architect analysis

We used the AmpliconSuite-pipeline (v.0.1555.1, https://github.com/AmpliconSuite/AmpliconSuite-pipeline) to invoke AmpliconArchitect⁵⁷ (v.1.3.r5) on a collection of copy-number seed regions generated using CNVkit⁵⁸ (v.0.9.9), with default settings.

Metaphase chromosome spread analysis

Cells were incubated with KaryoMAX (catalogue no. 15212012; Thermo Fisher Scientific) treatment at 0.05 μg ml⁻¹ for 1 h (mouse cells) or at 0.1 μg ml⁻¹ for 1 h and 30 min (human cells). A single-cell suspension was then collected, washed in PBS, and treated with 75 mM KCl for 10 min at 37 °C. Samples were then fixed in ice-cold 3:1 methanol/glacial acetic acid (Carnoy’s fixative) for 20 min and washed a further three times with Carnoy’s fixative. Fixed cells were dropped on to a glass slide in a humidified chamber and counterstained with DAPI (Vector Laboratories, H-1800). Images were acquired with an AX10 Imager.Z1 Zeiss microscope through a ×63 objective lens. Zeiss Zen 2.3 Pro software was used for image acquisition. Fiji (v.2.0.0-rc-65/1.15w) was used for image analysis and for brightness and contrast adjustments. Fiji’s ‘Invert LUT’ and ‘Shadows’ postprocessing commands were sequentially applied to better visualize ecDNAs.

FISH analysis

DNA FISH was performed on fixed cells using a two-colour probe. MDM2 (green dUTP) and centromeric control (orange dUTP) FISH probes were purchased from Empire Genomics (SKU MDM2-CHR12). BAC clones containing the murine Myc locus (RP23-130M7, RP23-342F3 RP23-454G15) were labelled with red dUTP, and RP23-333G9 (15qA1) labelled with green dUTP served as the control. Myc (RP23-307D14-ORANGE) and centromeric control (RP23-333G9-GREEN) FISH probes were also purchased from Empire Genomics. All RP23 clones were purchased from the Roswell Park Cancer Institute Genomics Shared Resource.

Probe labelling, hybridization, posthybridization washing and fluorescence detection were performed according to procedures established at the Molecular Cytogenetics Core Facility. Slides were scanned using a Zeiss Axioplan 2i epifluorescence microscope (Carl Zeiss Microscopy) equipped with Isis imaging software (MetaSystems Group Inc.) or Leica SP5 confocal microscope (Leica) with a ×63 objective. The entire hybridized area was scanned through a ×63 objective lens to assess the quality of hybridization and signal pattern. To the extent possible, apoptotic cells and bodies were excluded.

The BAC clone RP23-428D5 (BACPAC) was used for detection of the murine Mdm2 locus, and the BAC clone RP23-309H16 was used for the detection of murine 10qA1 (Cen10). Following inoculation, bacterial cells were pelleted, and BAC DNA was extracted using a NucleoBond Xtra BAC kit (Takara, catalogue no. 740436) as per the manufacturer’s instructions. The probe for Mdm2 was labelled with ChromaTide Alexa Fluor 568-5-dUTP (Thermo, C11399), and the Cen10 probe was labelled with ChromaTide Alexa Fluor 488-5-dUTP (Thermo, C11397) as per manufacturer’s instructions. Before hybridization, the labelled probe was preannealed with mouse COT-1 DNA in hybridization buffer (2× SSC, 50% formamide, 10% dextran sulfate) for 90 min at 37 °C. Hybridization of slides using preannealed probes was performed at 72 °C for 2 min, followed by 37 °C overnight. Posthybridization washes were conducted in 0.4× SSC/0.3% Igepal at 72 °C for 2 min, followed by 2× SSC at room temperature for 5 min. Slides were then rinsed briefly in water, air-dried, counterstained with DAPI (Thermo, D1306) and mounted with Prolong Diamond Antifade Mountant (Thermo, P36965). Images were acquired in the MSKCC Molecular Cytology Core using a Zeiss Imager equipped with a Zeiss AxioCam Mrm camera and a ×100 oil objective. Specimens for DNA FISH were embedded in optimal cutting temperature compound and stored at −80 °C before analysis.

RNA in situ hybridization

Mdm2 RNA FISH was performed in collaboration with the MSKCC Molecular Cytology Core. Briefly, paraffin-embedded tissue sections were cut at 5 μm and kept at 4 °C. Samples were loaded into a Leica Bond RX autostainer, baked for 30 min at 60 °C, dewaxed with Bond Dewax Solution (Leica, AR9222) and pretreated with EDTA-based epitope retrieval ER2 solution (Leica, AR9640) for 15 min at 95 °C. The mouse Mdm2 probe (Advanced Cell Diagnostics (ACD), catalogue no. 447648) was hybridized for 2 h at 42 °C. Mouse PPIB (ACD, catalogue no. 313918) and dapB (ACD, catalogue no. 312038) probes were used as positive and negative controls, respectively. The hybridized probes were detected using an RNAscope 2.5 LS Reagent Kit – Brown (ACD, catalogue no. 322100) according to the manufacturer’s instructions with the following modifications: DAB application was omitted and replaced with fluorescent CF594/tyramide (Biotium, B40953) for 20 min at room temperature. Images were acquired using a Zeiss Imager equipped with a Zeiss AxioCam Mrm camera, a ×20 air objective and a ×100 oil objective.

Statistics and reproducibility

Paired or unpaired Student’s two-tailed t-test and one-way ANOVA (corrected for multiple comparisons, Tukey test), were used to compare two or more groups, respectively, and to determine statistical significance (GraphPad Prism 9 and R software). Welch’s correction was used for populations with unequal variances. Unless otherwise indicated, the mean value and the standard deviation of each condition are shown. Differences were considered significant at P 

Materials availability

Materials are available from the corresponding authors upon request. Plasmids containing the ‘circularization cassettes’ described in this paper are available through Addgene (Plasmids #219563, #219564, #219565). Myc^ec (strain: 039221) and Mdm2^ec (strain: 039222) are available through the JAX repository (https://www.jax.org/).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.